Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
35 Results for "
DNA reduction
" in MedChemExpress (MCE) Product Catalog:
Products (35)
35 Results for "DNA reduction" in MCE Product Catalog:
25
25 Publications Verification
Cat. No.: HY-W011500
CAS No.: 51805-45-9
Synonyms: Tris(2-carboxyethyl)phosphine hydrochloride
Target:
Research Areas:
TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .
1
Target:
Research Areas:
Amotosalen hydrochloride (S-59) is a light-activated, DNA-, RNA-crosslinking psoralen compound, which is used to neutralise pathogens. Light-activated Amotosalen binds and permanently crosslinks DNA, preventing replication and thus stopping proliferation of donor T cells. Amotosalen can be used for the study of blood system pathogen reduction technology and graft-versus-host disease (GVHD) .
1
1 Cited Publications
Cat. No.: HY-W011500S
CAS No.: 1174025-33-2
1
1
1 Cited Publications
Cat. No.: HY-177022
CAS No.: 2495324-66-6
ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB) .
1
Target:
Research Areas:
BOLD-100 (NKP-1339; IT-139) is the first-in-class ruthenium-based anticancer agent in development against solid cancer with limited side effects. BOLD-100 induces G2/M cell cycle arrest, blockage of DNA synthesis, and induction of apoptosis via the mitochondrial pathway. BOLD-100 has a high tumor targeting potential, strongly binds to serum proteins such as albumin and transferrin and activates in the reductive tumor milieu .
1
Category:
Other Alkaloids Other Diseases Glucosinolates Plants Other Families Extract Disease Research Fields
Target:
Cat. No.: HY-W011142
CAS No.: 42155-08-8
Synonyms: dUMP disodium
Target:
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: CB 1954
Research Areas:
Tretazicar (CB 1954), an antitumor proagent, is highly selective against the Walker 256 rat tumour line. Tretazicar is enzymatically activated to generate a bifunctional agent, which can form DNA-DNA interstrand cross-links. Tretazicar in rat cells involves the reduction of its 4-nitro group to a 4-hydroxylamine by the enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-W115721
CAS No.: 523-21-7
Synonyms: Sodium rhodizonate dibasic
Target:
Research Areas:
P62-RNF168 agonist-1 (compound 5a) is a low cytotoxicity P62-RNF168 agonist that enhances the interaction between P62 and RNF168. P62-RNF168 agonist-1 induces a reduction in H2A ubiquitination mediated by RNF168 and impairs homologous recombination-mediated DNA repair. P62-RNF168 agonist-1 also inhibits the growth of xenograft tumors in mice in a dose-dependent manner .
Target:
Research Areas:
Aniline mustard (N,N-Bis(2-chloroethyl)aniline) is a DNA cross-linking agent. Aniline mustard can be released from quinone-based prodrugs after NQO1-mediated reduction. Aniline mustard exhibits antitumor activity in mice. Aniline mustard can be used for research on tumors .
Cat. No.: HY-158143
CAS No.: 2918814-97-6
Target:
Research Areas:
AZD3470 is an orally active MTA-cooperative PRMT5 inhibitor, selective for MTAP-deficient tumors. AZD3470 induces cell cycle G2/M phase alterations, DNA damage, apoptosis, and symmetric dimethylarginine reduction. AZD3470 alters alternative splicing, increases skipped exon events in DNA repair and cell cycle pathways, and inhibits cancer cell proliferation and tumor growth. AZD3470 can be used for the research of non-small cell lung cancer and MTAP-deleted solid tumors .
Cat. No.: HY-W013159S
Synonyms: 5′-dGMP-13C10,15N5 disodium
Cat. No.: HY-W394006
CAS No.: 964-26-1
Synonyms: dUMP
Target:
Research Areas:
2'-Deoxyuridine 5'-monophosphate (dUMP) is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .
Cat. No.: HY-120805
CAS No.: 13191-64-5
Category:
Human Gut Microbiota Metabolites Flavonoids Microorganisms Endogenous metabolite Other Flavonoids
Target:
Cat. No.: HY-18716
CAS No.: 1124347-33-6
Dextrorotation nimorazole phosphate ester is a fourth-generation nitroimidazole phosphate prodrug that generates DNA-damaging free radicals through anaerobic-specific nitro reduction. Dextrorotation nimorazole phosphate ester can be used to research anaerobic bacterial and protozoan infections .
- 1
- 2
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
